ID: 900725938

View in Genome Browser
Species Human (GRCh38)
Location 1:4216368-4216390
Sequence TGAAAAGGAGAGATGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725938_900725944 26 Left 900725938 1:4216368-4216390 CCTTCTCTCATCTCTCCTTTTCA No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data
900725938_900725945 27 Left 900725938 1:4216368-4216390 CCTTCTCTCATCTCTCCTTTTCA No data
Right 900725945 1:4216418-4216440 CAGTTTTGCATGAGTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725938 Original CRISPR TGAAAAGGAGAGATGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr