ID: 900725939

View in Genome Browser
Species Human (GRCh38)
Location 1:4216383-4216405
Sequence GAAAGACTTTCACTGTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725939_900725945 12 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725945 1:4216418-4216440 CAGTTTTGCATGAGTGTAGAGGG No data
900725939_900725947 17 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725947 1:4216423-4216445 TTGCATGAGTGTAGAGGGCTGGG No data
900725939_900725951 26 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725951 1:4216432-4216454 TGTAGAGGGCTGGGGACCTGGGG No data
900725939_900725944 11 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data
900725939_900725950 25 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725950 1:4216431-4216453 GTGTAGAGGGCTGGGGACCTGGG No data
900725939_900725948 18 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725948 1:4216424-4216446 TGCATGAGTGTAGAGGGCTGGGG No data
900725939_900725949 24 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725949 1:4216430-4216452 AGTGTAGAGGGCTGGGGACCTGG No data
900725939_900725946 16 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725946 1:4216422-4216444 TTTGCATGAGTGTAGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725939 Original CRISPR GAAAGACTTTCACTGTGAAA AGG (reversed) Intergenic
No off target data available for this crispr