ID: 900725944

View in Genome Browser
Species Human (GRCh38)
Location 1:4216417-4216439
Sequence CCAGTTTTGCATGAGTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725938_900725944 26 Left 900725938 1:4216368-4216390 CCTTCTCTCATCTCTCCTTTTCA No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data
900725939_900725944 11 Left 900725939 1:4216383-4216405 CCTTTTCACAGTGAAAGTCTTTC No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data
900725936_900725944 28 Left 900725936 1:4216366-4216388 CCCCTTCTCTCATCTCTCCTTTT No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data
900725937_900725944 27 Left 900725937 1:4216367-4216389 CCCTTCTCTCATCTCTCCTTTTC No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725944 Original CRISPR CCAGTTTTGCATGAGTGTAG AGG Intergenic
No off target data available for this crispr