ID: 900726980

View in Genome Browser
Species Human (GRCh38)
Location 1:4222970-4222992
Sequence CAGGCTACACACACCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900726980_900726984 11 Left 900726980 1:4222970-4222992 CCCAGGAAGGTGTGTGTAGCCTG No data
Right 900726984 1:4223004-4223026 AACCCAAAAGTATCTGAGACAGG 0: 46
1: 167
2: 250
3: 246
4: 410
900726980_900726987 21 Left 900726980 1:4222970-4222992 CCCAGGAAGGTGTGTGTAGCCTG No data
Right 900726987 1:4223014-4223036 TATCTGAGACAGGTTTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900726980 Original CRISPR CAGGCTACACACACCTTCCT GGG (reversed) Intergenic
No off target data available for this crispr