ID: 900727482

View in Genome Browser
Species Human (GRCh38)
Location 1:4226559-4226581
Sequence GGATTTTAACAACCTGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900727479_900727482 19 Left 900727479 1:4226517-4226539 CCCTATTAAAAAATGTTTTAAAC No data
Right 900727482 1:4226559-4226581 GGATTTTAACAACCTGCACCAGG No data
900727480_900727482 18 Left 900727480 1:4226518-4226540 CCTATTAAAAAATGTTTTAAACA No data
Right 900727482 1:4226559-4226581 GGATTTTAACAACCTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900727482 Original CRISPR GGATTTTAACAACCTGCACC AGG Intergenic
No off target data available for this crispr