ID: 900731295

View in Genome Browser
Species Human (GRCh38)
Location 1:4262555-4262577
Sequence GTATATATGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 2, 1: 1, 2: 2, 3: 14, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900731288_900731295 3 Left 900731288 1:4262529-4262551 CCTCAAGTGTGGTGGACACCAGC No data
Right 900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG 0: 2
1: 1
2: 2
3: 14
4: 195
900731285_900731295 23 Left 900731285 1:4262509-4262531 CCAAAGCTGAAAGAGGAGGTCCT No data
Right 900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG 0: 2
1: 1
2: 2
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900731295 Original CRISPR GTATATATGCAGAGGCTGGA GGG Intergenic
900002157 1:20591-20613 GTATAAATACAGAAGGTGGAGGG + Intergenic
900021878 1:191114-191136 GTATAAATACAGAAGGTGGAGGG + Intergenic
900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG + Intergenic
901248945 1:7758017-7758039 ATATATATGCAGAGGGTGAGAGG - Intronic
901634115 1:10662804-10662826 GTATGTCTGCAGAGGCAGGAAGG - Intronic
902389786 1:16096514-16096536 ATATATAAGCTGAGGCTTGAAGG - Intergenic
903558955 1:24213521-24213543 GTATACATAAAAAGGCTGGAAGG - Intergenic
904342842 1:29848857-29848879 GTATATATGCTGAGAAAGGAAGG + Intergenic
904629956 1:31833606-31833628 GCAGACATGCAGGGGCTGGATGG + Intergenic
905838851 1:41156025-41156047 GTATTTCAGCAGAGGCTGGAAGG - Intronic
905923367 1:41733462-41733484 GGATATAGGGAGAGGCTGGATGG - Intronic
907183215 1:52588863-52588885 GTATGTATGCAAAAGTTGGAGGG + Intergenic
907265869 1:53260613-53260635 GTATAGATGCAGAGGATGGGAGG + Intronic
908600127 1:65729657-65729679 GTATGTTTGCAGAGGCTCAAGGG + Intergenic
910369907 1:86504277-86504299 GTGTAAGCGCAGAGGCTGGAGGG - Intergenic
910478542 1:87634253-87634275 GTTTATAGGCACAGGATGGAGGG + Intergenic
912930082 1:113950210-113950232 GTATATGTGCAGGGGGTTGAGGG - Intronic
916188242 1:162153692-162153714 GTATATATTCACAGACAGGAGGG - Intronic
916420753 1:164635616-164635638 TGATATATGGCGAGGCTGGATGG - Intronic
916589505 1:166176701-166176723 GTGAATGTGCAGAGGCTAGAGGG - Intergenic
917691287 1:177472070-177472092 GTTTATATGCAGGAGCTGCAGGG - Intergenic
921709528 1:218359767-218359789 GTTTGTGTGGAGAGGCTGGAGGG + Intronic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1070335654 10:75453023-75453045 GTATATTTGGGGTGGCTGGAGGG + Intronic
1070448561 10:76533729-76533751 GTATTTAGGTAAAGGCTGGATGG + Intronic
1076422402 10:130340667-130340689 GGATGGAGGCAGAGGCTGGAGGG - Intergenic
1076981378 11:206790-206812 ATAAATATGAAGTGGCTGGAAGG - Intronic
1078527638 11:12112236-12112258 GCATCTTTTCAGAGGCTGGAAGG - Intronic
1078916643 11:15784466-15784488 GTAAATCTGCAAAGCCTGGAGGG - Intergenic
1079868516 11:25765359-25765381 GTACAAGTCCAGAGGCTGGAGGG + Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1085850668 11:80115802-80115824 GTACATGGGCAGAGGGTGGATGG + Intergenic
1086566837 11:88236681-88236703 GCATCTATGCAAAGGCTGCAAGG - Intergenic
1088084034 11:105956613-105956635 GTATATATGCAGTAACAGGATGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091375222 12:20626-20648 GTATAAATACAGAAGGTGGAGGG + Intergenic
1091947821 12:4564108-4564130 GGATATATGCAGAGGGTCCAAGG + Intronic
1091959456 12:4680016-4680038 GGATATATGCAGATGCAGGTAGG + Intronic
1092132665 12:6123547-6123569 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1092788507 12:12051443-12051465 GTATTCAAGCAGAGGCAGGATGG - Intronic
1093162384 12:15763675-15763697 CTATATATGCACACGCTGCATGG + Intronic
1093548366 12:20374312-20374334 ATAAATTTACAGAGGCTGGAAGG + Intronic
1096427774 12:51518583-51518605 GTGTATATGGAGGGACTGGAGGG + Intergenic
1097338052 12:58406745-58406767 GCATAAAAGCAGAGGCTAGAGGG + Intergenic
1097507467 12:60494066-60494088 TTATCTAGGCAGAGGCTGGTGGG + Intergenic
1098602608 12:72350133-72350155 GAATATATGCAGAGACAGGATGG - Intronic
1098608755 12:72427779-72427801 GTGTTCATGCACAGGCTGGATGG + Intronic
1100727643 12:97425790-97425812 GTATATTTGAAGAGGCTGTGTGG + Intergenic
1103192426 12:119013038-119013060 GCATATCTGGAGATGCTGGAGGG - Intronic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1104141427 12:125989937-125989959 GTATTTAGGGAGTGGCTGGATGG + Intergenic
1104313922 12:127679576-127679598 GCATTTATGCAGGGGCAGGAAGG - Intergenic
1105991820 13:25629715-25629737 GTAAAAAGGCAGAGGGTGGAAGG - Intronic
1107103381 13:36618008-36618030 GGATCTGTGCAGAGGCTGGTGGG + Intergenic
1107780379 13:43895438-43895460 CTATATATTCAGCAGCTGGAAGG + Intergenic
1109055815 13:57547106-57547128 GTTTATGTGCAGAGTTTGGAGGG - Intergenic
1109382403 13:61581128-61581150 GTATTTATGAAGAAGCTGAAGGG + Intergenic
1109530194 13:63632792-63632814 GTATATAAGAAAAGTCTGGATGG - Intergenic
1109721670 13:66283338-66283360 AAATATAGGCAGAGGCTGCATGG + Intergenic
1111076028 13:83236637-83236659 GTACATATACAGACGCTGAATGG + Intergenic
1111584140 13:90262257-90262279 GGTAATAGGCAGAGGCTGGAAGG - Intergenic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1113304633 13:109064324-109064346 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1114484747 14:23056008-23056030 GAATACATGCAGAGCCTGGGTGG - Intronic
1115533820 14:34353853-34353875 GTATGTATGTATAAGCTGGAAGG + Intronic
1118575478 14:67238153-67238175 GTATATATGCAAAAACTGAAGGG - Intergenic
1118658312 14:67978396-67978418 GAAAAAACGCAGAGGCTGGAGGG - Intronic
1121396302 14:93626282-93626304 GTGTAGGTGCAGAAGCTGGAAGG - Intronic
1121458620 14:94055792-94055814 GAATAGTTGCTGAGGCTGGAGGG - Intronic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1125026927 15:35040112-35040134 ATATATATGAAAAGGCTAGAAGG + Intergenic
1125118411 15:36122851-36122873 GCATTTAAGCAGAGGCTGAAGGG + Intergenic
1129154247 15:73707894-73707916 GCATTAGTGCAGAGGCTGGAAGG + Intronic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1129714150 15:77837248-77837270 GCGTATATGCAAAGGCAGGAAGG - Intergenic
1130184554 15:81667656-81667678 GTATATATGTATATACTGGAAGG - Intergenic
1132204538 15:99977335-99977357 ATATATATGAAGAGGAGGGACGG - Intronic
1132341894 15:101084129-101084151 GTATAAATGACAAGGCTGGAAGG + Intergenic
1135487570 16:22879464-22879486 GGATAAAGGCAGAGGGTGGATGG + Intronic
1135908711 16:26539719-26539741 ATATATATACATAGGCTGGCTGG - Intergenic
1138472173 16:57246342-57246364 GCATAGATTCAGAGGCTGGAAGG + Intronic
1139050009 16:63113048-63113070 GTATATAACCAGAGGCTCTAGGG - Intergenic
1139106720 16:63835372-63835394 TGATCTATGCAGAGCCTGGAGGG + Intergenic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1140266326 16:73424423-73424445 GTACATATGCAGAAGGTGCAAGG - Intergenic
1140823915 16:78688593-78688615 GTAGAGAAGCAGTGGCTGGAAGG - Intronic
1140953504 16:79841236-79841258 TGATAAATGCACAGGCTGGAGGG - Intergenic
1142051186 16:87959434-87959456 GTAGAGAGGCAGTGGCTGGATGG + Intronic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1151677511 17:75606189-75606211 GTATTCAAGCAGAGGCTGCACGG - Intergenic
1151906126 17:77050545-77050567 GTATATATGCATAGGCGGTGAGG + Intergenic
1151968770 17:77446295-77446317 GGATGGAGGCAGAGGCTGGAGGG - Intronic
1152307071 17:79527359-79527381 TTCTATATGCAGTGGCAGGATGG - Intergenic
1153886922 18:9475538-9475560 GTAAACAGGCAGAGGCTGGGCGG + Intronic
1158868508 18:61661284-61661306 GTAGATCTGCAGAGGGTGAAGGG - Intergenic
1159580997 18:70234697-70234719 GAAAATATCCAGAGGCAGGATGG - Intergenic
1160633910 19:62199-62221 GTATAAATACAGAAGGTGGAGGG + Intergenic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1164158568 19:22611482-22611504 GTCTGTGTGCAGAGGCTGGGAGG + Intergenic
1164455612 19:28404138-28404160 GTGTACATGGGGAGGCTGGATGG + Intergenic
1165112473 19:33510415-33510437 GTATATATGCAGAGGCTGGAAGG + Intronic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927883103 2:26702645-26702667 GTATACAAGCAGACACTGGATGG + Intronic
928143829 2:28753228-28753250 GTACATATGCAATCGCTGGACGG - Intronic
931212421 2:60210140-60210162 GTATACATGCATAGGTTAGATGG + Intergenic
933382927 2:81572791-81572813 ATATAAATGCCGAGGTTGGAAGG - Intergenic
935401220 2:102662542-102662564 GGGTATTTGCAAAGGCTGGAGGG + Intronic
936067090 2:109340491-109340513 GAATATGGGCAGATGCTGGAGGG + Intronic
936567569 2:113592830-113592852 GTATAAATACAGAAGGTGGAGGG - Intergenic
939734641 2:145828790-145828812 TTTTAAATGCAGAGGCTGGTTGG - Intergenic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
944609008 2:201380978-201381000 GGATTTAGGGAGAGGCTGGAGGG + Exonic
945867697 2:215194906-215194928 ATATGTATGCAGTGGCTGGTTGG + Intergenic
945914596 2:215689952-215689974 GAATATCTTCAAAGGCTGGATGG + Intergenic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
948904926 2:240975221-240975243 GAATAGATGCAGAGGCAGCAGGG + Intronic
1169251027 20:4061194-4061216 GTGACTATGCAGAGGCTGCAGGG - Intergenic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169281425 20:4270435-4270457 GAATATTTGAAGAGGGTGGAGGG - Intergenic
1170594017 20:17792186-17792208 GTAGAAATGCAGAGTATGGAGGG + Intergenic
1173943529 20:46932277-46932299 TTAGCTATGCAGAGACTGGAAGG - Intronic
1174056955 20:47804561-47804583 GTATATATACAGAGGCTGGAGGG - Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175801637 20:61804405-61804427 GGCCAGATGCAGAGGCTGGACGG - Intronic
1177982497 21:27931800-27931822 GGATATAAGCAGAAGATGGATGG - Intergenic
1181331309 22:22094027-22094049 GTATATAACCAGAGGGTGCAAGG - Intergenic
1182396896 22:30042724-30042746 GTATACATGAGGACGCTGGAAGG - Intergenic
1184233928 22:43173114-43173136 GTACATAGTCAGAGGCTGGCGGG - Intronic
1184673151 22:46026188-46026210 GTATATCTGGAGAAGCTGGAAGG + Intergenic
949698248 3:6724442-6724464 GATTATAAGCAGAGGCTGAAAGG - Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
951434464 3:22645531-22645553 GTTTAGGTGCAGAGGCTGTATGG + Intergenic
954430841 3:50470183-50470205 GTAGAGATGCAGTGGCAGGAAGG - Intronic
954431923 3:50475464-50475486 GTGGAGATGCAGAGGCTGGGAGG - Intronic
954573925 3:51664322-51664344 GTCTGTGTGCAGAGGCTGGGAGG + Exonic
956081688 3:65564056-65564078 GCATATCTCCAGAGGCTGAAAGG + Intronic
957733327 3:84172944-84172966 TTATGTATGTAGAGTCTGGAAGG + Intergenic
961723004 3:128908471-128908493 GTATTTATGCTGAAGCTGTAGGG - Intronic
969081821 4:4625012-4625034 GAATATAAGCAGAGACTTGAGGG + Intergenic
969122249 4:4919197-4919219 GGGCATATGCAGAGGCTGGTGGG - Intergenic
970422600 4:15919373-15919395 GTAAAGAGGCAGGGGCTGGAGGG + Intergenic
971790208 4:31160484-31160506 GTGAATATGCAGTGGGTGGAGGG + Intergenic
971811579 4:31434779-31434801 GTAAATATCCAGAGGTGGGATGG - Intergenic
972218541 4:36925301-36925323 GTATATATACAGTTTCTGGATGG + Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
975237785 4:72020495-72020517 GTACAGAAGCAAAGGCTGGAAGG - Intergenic
975874340 4:78818220-78818242 GTATATATCCAAAGGGTTGATGG - Intronic
977719674 4:100224538-100224560 GTATAGATGCAGAGGCTGCTGGG + Intergenic
977844119 4:101746472-101746494 GAATATTTGCAGAGTCTGGGTGG - Intronic
978891067 4:113828249-113828271 GAACATATTCAGAGGCTGCACGG + Intergenic
982551915 4:156812864-156812886 GTAGGTGTGCAGAGGTTGGAGGG - Intronic
983372479 4:166879111-166879133 ATATATATGCAGAGTGTAGATGG + Intronic
983430477 4:167643809-167643831 GTATATATACAAAGACTAGAAGG - Intergenic
984764756 4:183391547-183391569 GCAAAGAGGCAGAGGCTGGAGGG - Intergenic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
989651832 5:43698957-43698979 GTATTTAGGCTGAGGTTGGATGG + Intronic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
995524341 5:113038715-113038737 GGATATATCCAGTGGCAGGAGGG - Intronic
995889516 5:116935073-116935095 TTAAAGATGCAGAGGCTGGCTGG + Intergenic
996815307 5:127567353-127567375 GCAAAGATGCAGGGGCTGGAGGG - Intergenic
997023752 5:130033290-130033312 GTATATATGCCGGGGTTGAAGGG - Intronic
998272258 5:140717568-140717590 GTTTATATGCAGTGCGTGGAAGG + Intergenic
998273048 5:140724821-140724843 GTTTATATGCAGTGACTGGAAGG + Intergenic
998639320 5:143991790-143991812 GACTAGATCCAGAGGCTGGAAGG + Intergenic
1002556905 5:180049041-180049063 TTAAATAAGCAGAGGCTGGTAGG + Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1007661564 6:43489934-43489956 GTTTATATGGAGTGCCTGGAGGG + Intronic
1008964034 6:57296535-57296557 GTATATATAGAGAGGGTGGTAGG + Intergenic
1010584516 6:77641974-77641996 GTTTATAGGCATAGGCTGGCAGG + Intergenic
1012353081 6:98277719-98277741 GAATAAATGCATAGTCTGGATGG + Intergenic
1013014022 6:106144917-106144939 GTAGAGATCCAGAGGCTGAATGG + Intergenic
1020936202 7:14466850-14466872 GTTTATATAGAGAGGCTAGATGG + Intronic
1022418570 7:30198955-30198977 GCAAATAGGCAGGGGCTGGAGGG + Intergenic
1022649721 7:32263320-32263342 GTATATATGCAGGGGGAGGAGGG - Intronic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1026454418 7:70558233-70558255 GTATCTGTTCAGGGGCTGGAGGG - Intronic
1026827138 7:73591530-73591552 GTATGCATGCAGAGAGTGGATGG - Intergenic
1028807332 7:95043606-95043628 GCAAAGATGCAGGGGCTGGAGGG - Intronic
1028830539 7:95322891-95322913 CTATATATGCCTGGGCTGGAGGG - Intronic
1030684417 7:112469875-112469897 GCATTGAAGCAGAGGCTGGAGGG - Intronic
1032428638 7:131842792-131842814 GTGTAGAGGCAGGGGCTGGAAGG - Intergenic
1033149260 7:138899107-138899129 GTAAATGTGTCGAGGCTGGAGGG - Exonic
1038014237 8:23499742-23499764 GTAGCCAGGCAGAGGCTGGATGG + Intergenic
1038239105 8:25791623-25791645 GTATATATGCAGAAGGGAGATGG + Intergenic
1039080735 8:33731777-33731799 GTGTATATGTTGAGGCTGTAGGG + Intergenic
1039807435 8:41012633-41012655 GCATAGAGGCAGAGGCTGGAGGG - Intergenic
1042563535 8:70091420-70091442 GTCTATTAGAAGAGGCTGGAAGG + Intergenic
1043012101 8:74893767-74893789 ATATAAATGCATAGGATGGATGG + Intergenic
1044114684 8:88320758-88320780 GTATATAAAAAGAGGCTAGAGGG - Intronic
1044334818 8:90968678-90968700 ATATATATGCACACACTGGAAGG + Intronic
1044748552 8:95394721-95394743 GGAAATATGGGGAGGCTGGAGGG - Intergenic
1046616463 8:116482995-116483017 GTACATTACCAGAGGCTGGAGGG + Intergenic
1046954773 8:120052012-120052034 GTACATGTGCAAGGGCTGGAGGG - Intergenic
1049021900 8:139962845-139962867 AAACTTATGCAGAGGCTGGAGGG + Intronic
1053303030 9:36965088-36965110 GTATTTATGCTGAGCCTGAAGGG - Intronic
1055821318 9:80267870-80267892 GAATTTATGAAGAGGATGGATGG - Intergenic
1057283826 9:93731533-93731555 GGATACAGGCAGAGACTGGATGG - Intergenic
1060820627 9:126659475-126659497 GAATGTGTGGAGAGGCTGGATGG - Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1190738357 X:53270489-53270511 GTATTTGAGCAGAGGCTTGAAGG - Intronic
1192631541 X:72781525-72781547 GTTTATATGCAGAGGCGGGAGGG - Intronic
1192634840 X:72807053-72807075 GTTTATATGCGGAGGCGAGAGGG - Intronic
1192646875 X:72913748-72913770 GTTTATATGCGGAGGCGAGAGGG + Intronic
1192650168 X:72939276-72939298 GTTTATATGCAGAGGCGGGAGGG + Intronic
1194287719 X:92030992-92031014 GTATATATGCAGCAGTGGGATGG + Intronic
1194467887 X:94255682-94255704 GTGTTTATGCAGGGGCAGGATGG - Intergenic
1195916290 X:109939498-109939520 GTATATATGCTGAGTAGGGAAGG + Intergenic
1197343263 X:125300211-125300233 GTATTTATACAGATGCTGCAGGG + Intergenic
1198146957 X:133867517-133867539 CTAGATATGCAGCTGCTGGAGGG + Intronic
1200605253 Y:5255552-5255574 GTATATATGCAGCAGTGGGATGG + Intronic