ID: 900735781

View in Genome Browser
Species Human (GRCh38)
Location 1:4298634-4298656
Sequence ATGGAGTGGGTGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900735774_900735781 12 Left 900735774 1:4298599-4298621 CCAAGCACTTGCTGACACTGCAT No data
Right 900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900735781 Original CRISPR ATGGAGTGGGTGAATGAGGA GGG Intergenic
No off target data available for this crispr