ID: 900736772

View in Genome Browser
Species Human (GRCh38)
Location 1:4304102-4304124
Sequence GGCCTGAGTGAGCTCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900736770_900736772 -7 Left 900736770 1:4304086-4304108 CCTCAAAGTAGGGACTGGCCTGA No data
Right 900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG No data
900736769_900736772 -6 Left 900736769 1:4304085-4304107 CCCTCAAAGTAGGGACTGGCCTG No data
Right 900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG No data
900736762_900736772 24 Left 900736762 1:4304055-4304077 CCTGGAATACTCTGAACATCCAC No data
Right 900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG No data
900736767_900736772 2 Left 900736767 1:4304077-4304099 CCTGAGGTCCCTCAAAGTAGGGA No data
Right 900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG No data
900736761_900736772 30 Left 900736761 1:4304049-4304071 CCACAACCTGGAATACTCTGAAC No data
Right 900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG No data
900736764_900736772 5 Left 900736764 1:4304074-4304096 CCACCTGAGGTCCCTCAAAGTAG No data
Right 900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900736772 Original CRISPR GGCCTGAGTGAGCTCCAGGC AGG Intergenic