ID: 900737222

View in Genome Browser
Species Human (GRCh38)
Location 1:4306640-4306662
Sequence CTCGAGGTGCACCGGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900737217_900737222 -6 Left 900737217 1:4306623-4306645 CCTGGTCTCAAGTGACCCTCGAG No data
Right 900737222 1:4306640-4306662 CTCGAGGTGCACCGGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900737222 Original CRISPR CTCGAGGTGCACCGGAGAGC AGG Intergenic
No off target data available for this crispr