ID: 900737654

View in Genome Browser
Species Human (GRCh38)
Location 1:4309177-4309199
Sequence ACATTGCCACAGGTGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900737654_900737660 23 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737660 1:4309223-4309245 GATGAGTTCATGTCCTTTGTAGG 0: 16091
1: 10313
2: 5870
3: 5110
4: 4277
900737654_900737661 24 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737661 1:4309224-4309246 ATGAGTTCATGTCCTTTGTAGGG 0: 16138
1: 11559
2: 7091
3: 4106
4: 2672
900737654_900737659 1 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737654_900737662 30 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737662 1:4309230-4309252 TCATGTCCTTTGTAGGGACATGG 0: 16442
1: 13236
2: 8551
3: 6361
4: 5759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900737654 Original CRISPR ACATTGCCACAGGTGGCCAG GGG (reversed) Intergenic
No off target data available for this crispr