ID: 900737659

View in Genome Browser
Species Human (GRCh38)
Location 1:4309201-4309223
Sequence AATTTAAATTCTCATAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900737654_900737659 1 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737650_900737659 24 Left 900737650 1:4309154-4309176 CCAGGCTATGCTCTCGGACATGG No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737655_900737659 0 Left 900737655 1:4309178-4309200 CCCTGGCCACCTGTGGCAATGTA No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737656_900737659 -1 Left 900737656 1:4309179-4309201 CCTGGCCACCTGTGGCAATGTAA No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737658_900737659 -9 Left 900737658 1:4309187-4309209 CCTGTGGCAATGTAAATTTAAAT No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737657_900737659 -6 Left 900737657 1:4309184-4309206 CCACCTGTGGCAATGTAAATTTA No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data
900737648_900737659 30 Left 900737648 1:4309148-4309170 CCACTGCCAGGCTATGCTCTCGG No data
Right 900737659 1:4309201-4309223 AATTTAAATTCTCATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900737659 Original CRISPR AATTTAAATTCTCATAAAAA AGG Intergenic
No off target data available for this crispr