ID: 900737660

View in Genome Browser
Species Human (GRCh38)
Location 1:4309223-4309245
Sequence GATGAGTTCATGTCCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41661
Summary {0: 16091, 1: 10313, 2: 5870, 3: 5110, 4: 4277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900737656_900737660 21 Left 900737656 1:4309179-4309201 CCTGGCCACCTGTGGCAATGTAA No data
Right 900737660 1:4309223-4309245 GATGAGTTCATGTCCTTTGTAGG 0: 16091
1: 10313
2: 5870
3: 5110
4: 4277
900737655_900737660 22 Left 900737655 1:4309178-4309200 CCCTGGCCACCTGTGGCAATGTA No data
Right 900737660 1:4309223-4309245 GATGAGTTCATGTCCTTTGTAGG 0: 16091
1: 10313
2: 5870
3: 5110
4: 4277
900737657_900737660 16 Left 900737657 1:4309184-4309206 CCACCTGTGGCAATGTAAATTTA No data
Right 900737660 1:4309223-4309245 GATGAGTTCATGTCCTTTGTAGG 0: 16091
1: 10313
2: 5870
3: 5110
4: 4277
900737654_900737660 23 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737660 1:4309223-4309245 GATGAGTTCATGTCCTTTGTAGG 0: 16091
1: 10313
2: 5870
3: 5110
4: 4277
900737658_900737660 13 Left 900737658 1:4309187-4309209 CCTGTGGCAATGTAAATTTAAAT No data
Right 900737660 1:4309223-4309245 GATGAGTTCATGTCCTTTGTAGG 0: 16091
1: 10313
2: 5870
3: 5110
4: 4277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900737660 Original CRISPR GATGAGTTCATGTCCTTTGT AGG Intergenic
Too many off-targets to display for this crispr