ID: 900737661

View in Genome Browser
Species Human (GRCh38)
Location 1:4309224-4309246
Sequence ATGAGTTCATGTCCTTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41566
Summary {0: 16138, 1: 11559, 2: 7091, 3: 4106, 4: 2672}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900737658_900737661 14 Left 900737658 1:4309187-4309209 CCTGTGGCAATGTAAATTTAAAT No data
Right 900737661 1:4309224-4309246 ATGAGTTCATGTCCTTTGTAGGG 0: 16138
1: 11559
2: 7091
3: 4106
4: 2672
900737654_900737661 24 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737661 1:4309224-4309246 ATGAGTTCATGTCCTTTGTAGGG 0: 16138
1: 11559
2: 7091
3: 4106
4: 2672
900737656_900737661 22 Left 900737656 1:4309179-4309201 CCTGGCCACCTGTGGCAATGTAA No data
Right 900737661 1:4309224-4309246 ATGAGTTCATGTCCTTTGTAGGG 0: 16138
1: 11559
2: 7091
3: 4106
4: 2672
900737655_900737661 23 Left 900737655 1:4309178-4309200 CCCTGGCCACCTGTGGCAATGTA No data
Right 900737661 1:4309224-4309246 ATGAGTTCATGTCCTTTGTAGGG 0: 16138
1: 11559
2: 7091
3: 4106
4: 2672
900737657_900737661 17 Left 900737657 1:4309184-4309206 CCACCTGTGGCAATGTAAATTTA No data
Right 900737661 1:4309224-4309246 ATGAGTTCATGTCCTTTGTAGGG 0: 16138
1: 11559
2: 7091
3: 4106
4: 2672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900737661 Original CRISPR ATGAGTTCATGTCCTTTGTA GGG Intergenic
Too many off-targets to display for this crispr