ID: 900737662

View in Genome Browser
Species Human (GRCh38)
Location 1:4309230-4309252
Sequence TCATGTCCTTTGTAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50349
Summary {0: 16442, 1: 13236, 2: 8551, 3: 6361, 4: 5759}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900737654_900737662 30 Left 900737654 1:4309177-4309199 CCCCTGGCCACCTGTGGCAATGT No data
Right 900737662 1:4309230-4309252 TCATGTCCTTTGTAGGGACATGG 0: 16442
1: 13236
2: 8551
3: 6361
4: 5759
900737657_900737662 23 Left 900737657 1:4309184-4309206 CCACCTGTGGCAATGTAAATTTA No data
Right 900737662 1:4309230-4309252 TCATGTCCTTTGTAGGGACATGG 0: 16442
1: 13236
2: 8551
3: 6361
4: 5759
900737655_900737662 29 Left 900737655 1:4309178-4309200 CCCTGGCCACCTGTGGCAATGTA No data
Right 900737662 1:4309230-4309252 TCATGTCCTTTGTAGGGACATGG 0: 16442
1: 13236
2: 8551
3: 6361
4: 5759
900737656_900737662 28 Left 900737656 1:4309179-4309201 CCTGGCCACCTGTGGCAATGTAA No data
Right 900737662 1:4309230-4309252 TCATGTCCTTTGTAGGGACATGG 0: 16442
1: 13236
2: 8551
3: 6361
4: 5759
900737658_900737662 20 Left 900737658 1:4309187-4309209 CCTGTGGCAATGTAAATTTAAAT No data
Right 900737662 1:4309230-4309252 TCATGTCCTTTGTAGGGACATGG 0: 16442
1: 13236
2: 8551
3: 6361
4: 5759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900737662 Original CRISPR TCATGTCCTTTGTAGGGACA TGG Intergenic
Too many off-targets to display for this crispr