ID: 900739045

View in Genome Browser
Species Human (GRCh38)
Location 1:4319394-4319416
Sequence GTGGCGCAGAAGGGGCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739045_900739050 3 Left 900739045 1:4319394-4319416 CCAGAATGCCCCTTCTGCGCCAC No data
Right 900739050 1:4319420-4319442 ATCCCCCGCCCCTGATCACCAGG No data
900739045_900739059 23 Left 900739045 1:4319394-4319416 CCAGAATGCCCCTTCTGCGCCAC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739045 Original CRISPR GTGGCGCAGAAGGGGCATTC TGG (reversed) Intergenic
No off target data available for this crispr