ID: 900739046

View in Genome Browser
Species Human (GRCh38)
Location 1:4319402-4319424
Sequence GGGATGCAGTGGCGCAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739046_900739059 15 Left 900739046 1:4319402-4319424 CCCCTTCTGCGCCACTGCATCCC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739046_900739050 -5 Left 900739046 1:4319402-4319424 CCCCTTCTGCGCCACTGCATCCC No data
Right 900739050 1:4319420-4319442 ATCCCCCGCCCCTGATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739046 Original CRISPR GGGATGCAGTGGCGCAGAAG GGG (reversed) Intergenic
No off target data available for this crispr