ID: 900739048

View in Genome Browser
Species Human (GRCh38)
Location 1:4319404-4319426
Sequence GGGGGATGCAGTGGCGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739048_900739059 13 Left 900739048 1:4319404-4319426 CCTTCTGCGCCACTGCATCCCCC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739048_900739050 -7 Left 900739048 1:4319404-4319426 CCTTCTGCGCCACTGCATCCCCC No data
Right 900739050 1:4319420-4319442 ATCCCCCGCCCCTGATCACCAGG No data
900739048_900739062 29 Left 900739048 1:4319404-4319426 CCTTCTGCGCCACTGCATCCCCC No data
Right 900739062 1:4319456-4319478 CCGCCGGCATTCACTCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739048 Original CRISPR GGGGGATGCAGTGGCGCAGA AGG (reversed) Intergenic
No off target data available for this crispr