ID: 900739049

View in Genome Browser
Species Human (GRCh38)
Location 1:4319413-4319435
Sequence ATCAGGGGCGGGGGATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739049_900739062 20 Left 900739049 1:4319413-4319435 CCACTGCATCCCCCGCCCCTGAT No data
Right 900739062 1:4319456-4319478 CCGCCGGCATTCACTCACCCTGG No data
900739049_900739059 4 Left 900739049 1:4319413-4319435 CCACTGCATCCCCCGCCCCTGAT No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739049 Original CRISPR ATCAGGGGCGGGGGATGCAG TGG (reversed) Intergenic
No off target data available for this crispr