ID: 900739054

View in Genome Browser
Species Human (GRCh38)
Location 1:4319425-4319447
Sequence TGCATCCTGGTGATCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739054_900739062 8 Left 900739054 1:4319425-4319447 CCGCCCCTGATCACCAGGATGCA No data
Right 900739062 1:4319456-4319478 CCGCCGGCATTCACTCACCCTGG No data
900739054_900739059 -8 Left 900739054 1:4319425-4319447 CCGCCCCTGATCACCAGGATGCA No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739054 Original CRISPR TGCATCCTGGTGATCAGGGG CGG (reversed) Intergenic
No off target data available for this crispr