ID: 900739059

View in Genome Browser
Species Human (GRCh38)
Location 1:4319440-4319462
Sequence AGGATGCATACTGCACCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739046_900739059 15 Left 900739046 1:4319402-4319424 CCCCTTCTGCGCCACTGCATCCC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739053_900739059 -7 Left 900739053 1:4319424-4319446 CCCGCCCCTGATCACCAGGATGC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739054_900739059 -8 Left 900739054 1:4319425-4319447 CCGCCCCTGATCACCAGGATGCA No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739049_900739059 4 Left 900739049 1:4319413-4319435 CCACTGCATCCCCCGCCCCTGAT No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739047_900739059 14 Left 900739047 1:4319403-4319425 CCCTTCTGCGCCACTGCATCCCC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739052_900739059 -6 Left 900739052 1:4319423-4319445 CCCCGCCCCTGATCACCAGGATG No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739045_900739059 23 Left 900739045 1:4319394-4319416 CCAGAATGCCCCTTCTGCGCCAC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739048_900739059 13 Left 900739048 1:4319404-4319426 CCTTCTGCGCCACTGCATCCCCC No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data
900739051_900739059 -5 Left 900739051 1:4319422-4319444 CCCCCGCCCCTGATCACCAGGAT No data
Right 900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739059 Original CRISPR AGGATGCATACTGCACCCGC CGG Intergenic
No off target data available for this crispr