ID: 900739841

View in Genome Browser
Species Human (GRCh38)
Location 1:4324058-4324080
Sequence ATTTGAAATCAGGCCAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900739841_900739845 30 Left 900739841 1:4324058-4324080 CCTAATTTGGCCTGATTTCAAAT No data
Right 900739845 1:4324111-4324133 ATTTTTAAAAGTGTTTACTCAGG No data
900739841_900739843 -1 Left 900739841 1:4324058-4324080 CCTAATTTGGCCTGATTTCAAAT No data
Right 900739843 1:4324080-4324102 TTATCTAATTAGAGAAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900739841 Original CRISPR ATTTGAAATCAGGCCAAATT AGG (reversed) Intergenic
No off target data available for this crispr