ID: 900741636

View in Genome Browser
Species Human (GRCh38)
Location 1:4333794-4333816
Sequence GAGAATCAACAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900741633_900741636 -2 Left 900741633 1:4333773-4333795 CCTAAGTGACCTTGGCAAGCTGA No data
Right 900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900741636 Original CRISPR GAGAATCAACAGAATGAGGA AGG Intergenic
No off target data available for this crispr