ID: 900743542

View in Genome Browser
Species Human (GRCh38)
Location 1:4344801-4344823
Sequence CTCCTTCAGATACCAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900743535_900743542 23 Left 900743535 1:4344755-4344777 CCACTTCTTCGAGGAAGCCTCCT No data
Right 900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG No data
900743533_900743542 25 Left 900743533 1:4344753-4344775 CCCCACTTCTTCGAGGAAGCCTC No data
Right 900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG No data
900743534_900743542 24 Left 900743534 1:4344754-4344776 CCCACTTCTTCGAGGAAGCCTCC No data
Right 900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG No data
900743537_900743542 6 Left 900743537 1:4344772-4344794 CCTCCTTGGTCAGCTCAGCCTGC No data
Right 900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG No data
900743538_900743542 3 Left 900743538 1:4344775-4344797 CCTTGGTCAGCTCAGCCTGCACA No data
Right 900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900743542 Original CRISPR CTCCTTCAGATACCAGTGGC AGG Intergenic
No off target data available for this crispr