ID: 900743802

View in Genome Browser
Species Human (GRCh38)
Location 1:4346507-4346529
Sequence GGGGTGGACAGGGCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900743793_900743802 16 Left 900743793 1:4346468-4346490 CCAGATGCACTGAATGGTCTTCT No data
Right 900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900743802 Original CRISPR GGGGTGGACAGGGCTGAGGA AGG Intergenic
No off target data available for this crispr