ID: 900745247

View in Genome Browser
Species Human (GRCh38)
Location 1:4356439-4356461
Sequence TCTCATTTGCCCCTGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900745233_900745247 19 Left 900745233 1:4356397-4356419 CCCTTGTGTCTCCTGTACCTCGT No data
Right 900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG No data
900745234_900745247 18 Left 900745234 1:4356398-4356420 CCTTGTGTCTCCTGTACCTCGTG No data
Right 900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG No data
900745232_900745247 20 Left 900745232 1:4356396-4356418 CCCCTTGTGTCTCCTGTACCTCG No data
Right 900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG No data
900745240_900745247 8 Left 900745240 1:4356408-4356430 CCTGTACCTCGTGGGGGGTGCAG No data
Right 900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG No data
900745241_900745247 2 Left 900745241 1:4356414-4356436 CCTCGTGGGGGGTGCAGCCCACC No data
Right 900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900745247 Original CRISPR TCTCATTTGCCCCTGCAGCC CGG Intergenic
No off target data available for this crispr