ID: 900749035

View in Genome Browser
Species Human (GRCh38)
Location 1:4382381-4382403
Sequence CCACTTCATGGAGGGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900749022_900749035 26 Left 900749022 1:4382332-4382354 CCAACCATGTGATTAGAGTGTGT No data
Right 900749035 1:4382381-4382403 CCACTTCATGGAGGGAGGGGAGG No data
900749023_900749035 22 Left 900749023 1:4382336-4382358 CCATGTGATTAGAGTGTGTCTGC No data
Right 900749035 1:4382381-4382403 CCACTTCATGGAGGGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900749035 Original CRISPR CCACTTCATGGAGGGAGGGG AGG Intergenic
No off target data available for this crispr