ID: 900749696

View in Genome Browser
Species Human (GRCh38)
Location 1:4387591-4387613
Sequence GTTCTCATGCTGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900749691_900749696 1 Left 900749691 1:4387567-4387589 CCCCTCATCACATGCCATCTGTC No data
Right 900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG No data
900749693_900749696 -1 Left 900749693 1:4387569-4387591 CCTCATCACATGCCATCTGTCTG No data
Right 900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG No data
900749692_900749696 0 Left 900749692 1:4387568-4387590 CCCTCATCACATGCCATCTGTCT No data
Right 900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900749696 Original CRISPR GTTCTCATGCTGAATGAGGA TGG Intergenic
No off target data available for this crispr