ID: 900750521

View in Genome Browser
Species Human (GRCh38)
Location 1:4394069-4394091
Sequence ATGTGGGTATGGAGGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900750510_900750521 19 Left 900750510 1:4394027-4394049 CCACTCTGGTAGATGATGCTGAT No data
Right 900750521 1:4394069-4394091 ATGTGGGTATGGAGGGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900750521 Original CRISPR ATGTGGGTATGGAGGGTACT TGG Intergenic
No off target data available for this crispr