ID: 900750625

View in Genome Browser
Species Human (GRCh38)
Location 1:4394832-4394854
Sequence GAGCTAGGGATCTCTAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900750613_900750625 15 Left 900750613 1:4394794-4394816 CCCCTTTCATGATCTGTGTTTTG No data
Right 900750625 1:4394832-4394854 GAGCTAGGGATCTCTAACTGGGG No data
900750614_900750625 14 Left 900750614 1:4394795-4394817 CCCTTTCATGATCTGTGTTTTGG No data
Right 900750625 1:4394832-4394854 GAGCTAGGGATCTCTAACTGGGG No data
900750616_900750625 13 Left 900750616 1:4394796-4394818 CCTTTCATGATCTGTGTTTTGGA No data
Right 900750625 1:4394832-4394854 GAGCTAGGGATCTCTAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900750625 Original CRISPR GAGCTAGGGATCTCTAACTG GGG Intergenic