ID: 900753792

View in Genome Browser
Species Human (GRCh38)
Location 1:4418941-4418963
Sequence TGTCCTGGTAGAGAACCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900753792_900753795 12 Left 900753792 1:4418941-4418963 CCCTTGGGTTCTCTACCAGGACA No data
Right 900753795 1:4418976-4418998 CTCCTCTTATCACCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900753792 Original CRISPR TGTCCTGGTAGAGAACCCAA GGG (reversed) Intergenic
No off target data available for this crispr