ID: 900755569

View in Genome Browser
Species Human (GRCh38)
Location 1:4432262-4432284
Sequence GGCTGGGTGGCAAGCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755569_900755577 -5 Left 900755569 1:4432262-4432284 CCCCACCAGCTTGCCACCCAGCC No data
Right 900755577 1:4432280-4432302 CAGCCCAGCTAAGGCCAGTCTGG No data
900755569_900755582 15 Left 900755569 1:4432262-4432284 CCCCACCAGCTTGCCACCCAGCC No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755569_900755583 22 Left 900755569 1:4432262-4432284 CCCCACCAGCTTGCCACCCAGCC No data
Right 900755583 1:4432307-4432329 GCCAAACTCCTGCTGGCCTGTGG No data
900755569_900755580 0 Left 900755569 1:4432262-4432284 CCCCACCAGCTTGCCACCCAGCC No data
Right 900755580 1:4432285-4432307 CAGCTAAGGCCAGTCTGGACAGG No data
900755569_900755586 30 Left 900755569 1:4432262-4432284 CCCCACCAGCTTGCCACCCAGCC No data
Right 900755586 1:4432315-4432337 CCTGCTGGCCTGTGGTCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755569 Original CRISPR GGCTGGGTGGCAAGCTGGTG GGG (reversed) Intergenic