ID: 900755571

View in Genome Browser
Species Human (GRCh38)
Location 1:4432264-4432286
Sequence TGGGCTGGGTGGCAAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755571_900755587 29 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755587 1:4432316-4432338 CTGCTGGCCTGTGGTCGTGTGGG No data
900755571_900755582 13 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755571_900755583 20 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755583 1:4432307-4432329 GCCAAACTCCTGCTGGCCTGTGG No data
900755571_900755577 -7 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755577 1:4432280-4432302 CAGCCCAGCTAAGGCCAGTCTGG No data
900755571_900755586 28 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755586 1:4432315-4432337 CCTGCTGGCCTGTGGTCGTGTGG No data
900755571_900755580 -2 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755580 1:4432285-4432307 CAGCTAAGGCCAGTCTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755571 Original CRISPR TGGGCTGGGTGGCAAGCTGG TGG (reversed) Intergenic