ID: 900755572

View in Genome Browser
Species Human (GRCh38)
Location 1:4432267-4432289
Sequence AGCTGGGCTGGGTGGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755572_900755577 -10 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755577 1:4432280-4432302 CAGCCCAGCTAAGGCCAGTCTGG No data
900755572_900755583 17 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755583 1:4432307-4432329 GCCAAACTCCTGCTGGCCTGTGG No data
900755572_900755587 26 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755587 1:4432316-4432338 CTGCTGGCCTGTGGTCGTGTGGG No data
900755572_900755586 25 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755586 1:4432315-4432337 CCTGCTGGCCTGTGGTCGTGTGG No data
900755572_900755582 10 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755572_900755580 -5 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755580 1:4432285-4432307 CAGCTAAGGCCAGTCTGGACAGG No data
900755572_900755588 29 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755588 1:4432319-4432341 CTGGCCTGTGGTCGTGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755572 Original CRISPR AGCTGGGCTGGGTGGCAAGC TGG (reversed) Intergenic