ID: 900755576

View in Genome Browser
Species Human (GRCh38)
Location 1:4432279-4432301
Sequence CAGACTGGCCTTAGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755576_900755586 13 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755586 1:4432315-4432337 CCTGCTGGCCTGTGGTCGTGTGG No data
900755576_900755588 17 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755588 1:4432319-4432341 CTGGCCTGTGGTCGTGTGGGCGG No data
900755576_900755587 14 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755587 1:4432316-4432338 CTGCTGGCCTGTGGTCGTGTGGG No data
900755576_900755589 20 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755576_900755582 -2 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755576_900755583 5 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755583 1:4432307-4432329 GCCAAACTCCTGCTGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755576 Original CRISPR CAGACTGGCCTTAGCTGGGC TGG (reversed) Intergenic