ID: 900755578

View in Genome Browser
Species Human (GRCh38)
Location 1:4432283-4432305
Sequence TGTCCAGACTGGCCTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755578_900755588 13 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755588 1:4432319-4432341 CTGGCCTGTGGTCGTGTGGGCGG No data
900755578_900755583 1 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755583 1:4432307-4432329 GCCAAACTCCTGCTGGCCTGTGG No data
900755578_900755582 -6 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755578_900755586 9 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755586 1:4432315-4432337 CCTGCTGGCCTGTGGTCGTGTGG No data
900755578_900755589 16 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755578_900755587 10 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755587 1:4432316-4432338 CTGCTGGCCTGTGGTCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755578 Original CRISPR TGTCCAGACTGGCCTTAGCT GGG (reversed) Intergenic