ID: 900755581

View in Genome Browser
Species Human (GRCh38)
Location 1:4432294-4432316
Sequence GGAGTTTGGCCTGTCCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755581_900755586 -2 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755586 1:4432315-4432337 CCTGCTGGCCTGTGGTCGTGTGG No data
900755581_900755589 5 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755581_900755588 2 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755588 1:4432319-4432341 CTGGCCTGTGGTCGTGTGGGCGG No data
900755581_900755592 30 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755592 1:4432347-4432369 ATTACAGAGCTTGAGTTCCAGGG No data
900755581_900755591 29 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755591 1:4432346-4432368 TATTACAGAGCTTGAGTTCCAGG No data
900755581_900755583 -10 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755583 1:4432307-4432329 GCCAAACTCCTGCTGGCCTGTGG No data
900755581_900755587 -1 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755587 1:4432316-4432338 CTGCTGGCCTGTGGTCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755581 Original CRISPR GGAGTTTGGCCTGTCCAGAC TGG (reversed) Intergenic