ID: 900755582

View in Genome Browser
Species Human (GRCh38)
Location 1:4432300-4432322
Sequence TGGACAGGCCAAACTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755572_900755582 10 Left 900755572 1:4432267-4432289 CCAGCTTGCCACCCAGCCCAGCT No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755569_900755582 15 Left 900755569 1:4432262-4432284 CCCCACCAGCTTGCCACCCAGCC No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755571_900755582 13 Left 900755571 1:4432264-4432286 CCACCAGCTTGCCACCCAGCCCA No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755578_900755582 -6 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755579_900755582 -7 Left 900755579 1:4432284-4432306 CCAGCTAAGGCCAGTCTGGACAG No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755575_900755582 -1 Left 900755575 1:4432278-4432300 CCCAGCCCAGCTAAGGCCAGTCT No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755576_900755582 -2 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755574_900755582 2 Left 900755574 1:4432275-4432297 CCACCCAGCCCAGCTAAGGCCAG No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data
900755570_900755582 14 Left 900755570 1:4432263-4432285 CCCACCAGCTTGCCACCCAGCCC No data
Right 900755582 1:4432300-4432322 TGGACAGGCCAAACTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755582 Original CRISPR TGGACAGGCCAAACTCCTGC TGG Intergenic