ID: 900755584

View in Genome Browser
Species Human (GRCh38)
Location 1:4432308-4432330
Sequence ACCACAGGCCAGCAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755584_900755591 15 Left 900755584 1:4432308-4432330 CCAAACTCCTGCTGGCCTGTGGT No data
Right 900755591 1:4432346-4432368 TATTACAGAGCTTGAGTTCCAGG No data
900755584_900755592 16 Left 900755584 1:4432308-4432330 CCAAACTCCTGCTGGCCTGTGGT No data
Right 900755592 1:4432347-4432369 ATTACAGAGCTTGAGTTCCAGGG No data
900755584_900755589 -9 Left 900755584 1:4432308-4432330 CCAAACTCCTGCTGGCCTGTGGT No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755584 Original CRISPR ACCACAGGCCAGCAGGAGTT TGG (reversed) Intergenic