ID: 900755589

View in Genome Browser
Species Human (GRCh38)
Location 1:4432322-4432344
Sequence GCCTGTGGTCGTGTGGGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900755578_900755589 16 Left 900755578 1:4432283-4432305 CCCAGCTAAGGCCAGTCTGGACA No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755584_900755589 -9 Left 900755584 1:4432308-4432330 CCAAACTCCTGCTGGCCTGTGGT No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755575_900755589 21 Left 900755575 1:4432278-4432300 CCCAGCCCAGCTAAGGCCAGTCT No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755581_900755589 5 Left 900755581 1:4432294-4432316 CCAGTCTGGACAGGCCAAACTCC No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755579_900755589 15 Left 900755579 1:4432284-4432306 CCAGCTAAGGCCAGTCTGGACAG No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755574_900755589 24 Left 900755574 1:4432275-4432297 CCACCCAGCCCAGCTAAGGCCAG No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data
900755576_900755589 20 Left 900755576 1:4432279-4432301 CCAGCCCAGCTAAGGCCAGTCTG No data
Right 900755589 1:4432322-4432344 GCCTGTGGTCGTGTGGGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900755589 Original CRISPR GCCTGTGGTCGTGTGGGCGG TGG Intergenic