ID: 900757227

View in Genome Browser
Species Human (GRCh38)
Location 1:4444646-4444668
Sequence ACTGACAACCTGAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900757217_900757227 30 Left 900757217 1:4444593-4444615 CCAGCAAGGAAATGAGACCTCAG No data
Right 900757227 1:4444646-4444668 ACTGACAACCTGAGGGAGCTTGG No data
900757221_900757227 13 Left 900757221 1:4444610-4444632 CCTCAGGGAAGTGGAAACTGCGG No data
Right 900757227 1:4444646-4444668 ACTGACAACCTGAGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900757227 Original CRISPR ACTGACAACCTGAGGGAGCT TGG Intergenic
No off target data available for this crispr