ID: 900757227 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:4444646-4444668 |
| Sequence | ACTGACAACCTGAGGGAGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900757217_900757227 | 30 | Left | 900757217 | 1:4444593-4444615 | CCAGCAAGGAAATGAGACCTCAG | No data | ||
| Right | 900757227 | 1:4444646-4444668 | ACTGACAACCTGAGGGAGCTTGG | No data | ||||
| 900757221_900757227 | 13 | Left | 900757221 | 1:4444610-4444632 | CCTCAGGGAAGTGGAAACTGCGG | No data | ||
| Right | 900757227 | 1:4444646-4444668 | ACTGACAACCTGAGGGAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900757227 | Original CRISPR | ACTGACAACCTGAGGGAGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||