ID: 900759256

View in Genome Browser
Species Human (GRCh38)
Location 1:4460160-4460182
Sequence CTACCTTGCAGCAGCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900759256_900759262 25 Left 900759256 1:4460160-4460182 CCACAGGAGCTGCTGCAAGGTAG No data
Right 900759262 1:4460208-4460230 GGGCTGTGTGTGCATCTGCCGGG No data
900759256_900759261 24 Left 900759256 1:4460160-4460182 CCACAGGAGCTGCTGCAAGGTAG No data
Right 900759261 1:4460207-4460229 CGGGCTGTGTGTGCATCTGCCGG No data
900759256_900759258 4 Left 900759256 1:4460160-4460182 CCACAGGAGCTGCTGCAAGGTAG No data
Right 900759258 1:4460187-4460209 AGATGGAGAGAGTTCAAGACCGG No data
900759256_900759259 5 Left 900759256 1:4460160-4460182 CCACAGGAGCTGCTGCAAGGTAG No data
Right 900759259 1:4460188-4460210 GATGGAGAGAGTTCAAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900759256 Original CRISPR CTACCTTGCAGCAGCTCCTG TGG (reversed) Intergenic
No off target data available for this crispr