ID: 900759877

View in Genome Browser
Species Human (GRCh38)
Location 1:4463420-4463442
Sequence CCTTCCTAGCTGGGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900759863_900759877 18 Left 900759863 1:4463379-4463401 CCCTCTGAGTCCATCAACCTCAC No data
Right 900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG No data
900759865_900759877 8 Left 900759865 1:4463389-4463411 CCATCAACCTCACTGCCTTCATC No data
Right 900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG No data
900759862_900759877 23 Left 900759862 1:4463374-4463396 CCAGGCCCTCTGAGTCCATCAAC No data
Right 900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG No data
900759866_900759877 1 Left 900759866 1:4463396-4463418 CCTCACTGCCTTCATCCATTAAC No data
Right 900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG No data
900759864_900759877 17 Left 900759864 1:4463380-4463402 CCTCTGAGTCCATCAACCTCACT No data
Right 900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG No data
900759867_900759877 -7 Left 900759867 1:4463404-4463426 CCTTCATCCATTAACCCCTTCCT No data
Right 900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900759877 Original CRISPR CCTTCCTAGCTGGGGCTGGT GGG Intergenic
No off target data available for this crispr