ID: 900760028

View in Genome Browser
Species Human (GRCh38)
Location 1:4464127-4464149
Sequence GGGCTGACAGTGGGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900760028_900760044 19 Left 900760028 1:4464127-4464149 CCCTCCAACCCCACTGTCAGCCC No data
Right 900760044 1:4464169-4464191 GTGTCAGGCTCTGCACACCCTGG No data
900760028_900760037 4 Left 900760028 1:4464127-4464149 CCCTCCAACCCCACTGTCAGCCC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900760028 Original CRISPR GGGCTGACAGTGGGGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr