ID: 900760031 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:4464131-4464153 |
| Sequence | GTCCGGGCTGACAGTGGGGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900760031_900760044 | 15 | Left | 900760031 | 1:4464131-4464153 | CCAACCCCACTGTCAGCCCGGAC | No data | ||
| Right | 900760044 | 1:4464169-4464191 | GTGTCAGGCTCTGCACACCCTGG | No data | ||||
| 900760031_900760037 | 0 | Left | 900760031 | 1:4464131-4464153 | CCAACCCCACTGTCAGCCCGGAC | No data | ||
| Right | 900760037 | 1:4464154-4464176 | TTGCCCCACCCCACAGTGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900760031 | Original CRISPR | GTCCGGGCTGACAGTGGGGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||