ID: 900760033

View in Genome Browser
Species Human (GRCh38)
Location 1:4464136-4464158
Sequence GGCAAGTCCGGGCTGACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900760033_900760044 10 Left 900760033 1:4464136-4464158 CCCACTGTCAGCCCGGACTTGCC No data
Right 900760044 1:4464169-4464191 GTGTCAGGCTCTGCACACCCTGG No data
900760033_900760037 -5 Left 900760033 1:4464136-4464158 CCCACTGTCAGCCCGGACTTGCC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900760033 Original CRISPR GGCAAGTCCGGGCTGACAGT GGG (reversed) Intergenic
No off target data available for this crispr