ID: 900760037

View in Genome Browser
Species Human (GRCh38)
Location 1:4464154-4464176
Sequence TTGCCCCACCCCACAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900760029_900760037 3 Left 900760029 1:4464128-4464150 CCTCCAACCCCACTGTCAGCCCG No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760028_900760037 4 Left 900760028 1:4464127-4464149 CCCTCCAACCCCACTGTCAGCCC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760034_900760037 -6 Left 900760034 1:4464137-4464159 CCACTGTCAGCCCGGACTTGCCC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760025_900760037 12 Left 900760025 1:4464119-4464141 CCCTCCTTCCCTCCAACCCCACT No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760026_900760037 11 Left 900760026 1:4464120-4464142 CCTCCTTCCCTCCAACCCCACTG No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760033_900760037 -5 Left 900760033 1:4464136-4464158 CCCACTGTCAGCCCGGACTTGCC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760032_900760037 -4 Left 900760032 1:4464135-4464157 CCCCACTGTCAGCCCGGACTTGC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760031_900760037 0 Left 900760031 1:4464131-4464153 CCAACCCCACTGTCAGCCCGGAC No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data
900760027_900760037 8 Left 900760027 1:4464123-4464145 CCTTCCCTCCAACCCCACTGTCA No data
Right 900760037 1:4464154-4464176 TTGCCCCACCCCACAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900760037 Original CRISPR TTGCCCCACCCCACAGTGTC AGG Intergenic
No off target data available for this crispr