ID: 900760404

View in Genome Browser
Species Human (GRCh38)
Location 1:4466719-4466741
Sequence CACTGTGTCTGCAGGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900760404_900760408 3 Left 900760404 1:4466719-4466741 CCTACTGCCCTGCAGACACAGTG No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900760404 Original CRISPR CACTGTGTCTGCAGGGCAGT AGG (reversed) Intergenic
No off target data available for this crispr