ID: 900760408

View in Genome Browser
Species Human (GRCh38)
Location 1:4466745-4466767
Sequence ACCTTCCCCCCACTTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900760404_900760408 3 Left 900760404 1:4466719-4466741 CCTACTGCCCTGCAGACACAGTG No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data
900760405_900760408 -4 Left 900760405 1:4466726-4466748 CCCTGCAGACACAGTGCCTACCT No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data
900760403_900760408 6 Left 900760403 1:4466716-4466738 CCTCCTACTGCCCTGCAGACACA No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data
900760401_900760408 25 Left 900760401 1:4466697-4466719 CCCATGGGCACAGTGTTAACCTC No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data
900760402_900760408 24 Left 900760402 1:4466698-4466720 CCATGGGCACAGTGTTAACCTCC No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data
900760400_900760408 26 Left 900760400 1:4466696-4466718 CCCCATGGGCACAGTGTTAACCT No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data
900760406_900760408 -5 Left 900760406 1:4466727-4466749 CCTGCAGACACAGTGCCTACCTT No data
Right 900760408 1:4466745-4466767 ACCTTCCCCCCACTTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900760408 Original CRISPR ACCTTCCCCCCACTTCCTCA TGG Intergenic
No off target data available for this crispr