ID: 900762696

View in Genome Browser
Species Human (GRCh38)
Location 1:4483543-4483565
Sequence TTAGATGCCCTCCTTTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900762696_900762699 -10 Left 900762696 1:4483543-4483565 CCAGTACAAAGGAGGGCATCTAA No data
Right 900762699 1:4483556-4483578 GGGCATCTAAGCCAGTCCCGGGG No data
900762696_900762707 26 Left 900762696 1:4483543-4483565 CCAGTACAAAGGAGGGCATCTAA No data
Right 900762707 1:4483592-4483614 TTGTCTAAACTAAGCCCCAAAGG No data
900762696_900762703 -1 Left 900762696 1:4483543-4483565 CCAGTACAAAGGAGGGCATCTAA No data
Right 900762703 1:4483565-4483587 AGCCAGTCCCGGGGGGCTGGAGG No data
900762696_900762700 -9 Left 900762696 1:4483543-4483565 CCAGTACAAAGGAGGGCATCTAA No data
Right 900762700 1:4483557-4483579 GGCATCTAAGCCAGTCCCGGGGG No data
900762696_900762701 -8 Left 900762696 1:4483543-4483565 CCAGTACAAAGGAGGGCATCTAA No data
Right 900762701 1:4483558-4483580 GCATCTAAGCCAGTCCCGGGGGG No data
900762696_900762702 -4 Left 900762696 1:4483543-4483565 CCAGTACAAAGGAGGGCATCTAA No data
Right 900762702 1:4483562-4483584 CTAAGCCAGTCCCGGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900762696 Original CRISPR TTAGATGCCCTCCTTTGTAC TGG (reversed) Intergenic
No off target data available for this crispr