ID: 900762704

View in Genome Browser
Species Human (GRCh38)
Location 1:4483567-4483589
Sequence CACCTCCAGCCCCCCGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900762704_900762714 26 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762714 1:4483616-4483638 TGAGTCCAGGGCACTTCAGGAGG No data
900762704_900762717 29 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762717 1:4483619-4483641 GTCCAGGGCACTTCAGGAGGGGG No data
900762704_900762707 2 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762707 1:4483592-4483614 TTGTCTAAACTAAGCCCCAAAGG No data
900762704_900762715 27 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762715 1:4483617-4483639 GAGTCCAGGGCACTTCAGGAGGG No data
900762704_900762708 13 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762708 1:4483603-4483625 AAGCCCCAAAGGCTGAGTCCAGG No data
900762704_900762713 23 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762713 1:4483613-4483635 GGCTGAGTCCAGGGCACTTCAGG No data
900762704_900762709 14 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762709 1:4483604-4483626 AGCCCCAAAGGCTGAGTCCAGGG No data
900762704_900762716 28 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762716 1:4483618-4483640 AGTCCAGGGCACTTCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900762704 Original CRISPR CACCTCCAGCCCCCCGGGAC TGG (reversed) Intergenic
No off target data available for this crispr